Download Free Medical DNA and Genes PowerPoint Presentation

DNA and Genes PowerPoint Presentation

DOWNLOAD MEDICAL POWERPOINT PRESENTATION

About This Presentation

Description : Check out this medical presentation on Genetics, which is titled "DNA and Genes", to know about DNA, the genetic code, and the human genome.

Tags : Genetics, DNA, Genes, genetic code, human genome

Published on : Jul 12, 2021 | Views : 1580 | Downloads : 0

Shareable Url :

Embed Code :

Comment

Transcript

Slide 1-

DNA and Genes
Slide 2-

Things to find out: What is DNA? The Genetic Code The Human Genome
Slide 3-

Diversity of Life All biological systems are composed of the same types of molecules Similar organization principles are used at the cellular level
Slide 4-

The Cell Basic component of life Two main categories, prokarytic and eukaryotic cells Differences in the nucleus
Slide 5-

Prokaryotes: no defined nucleus and a simplified internal structure Eukaryotes: membrane limited nucleus and complicated internal structure Three branches of life
Slide 6-

Genetic material is located in nucleus The genetic information is stored in Deoxyribonucleic acid, DNA DNA contains the information needed to build an individual
Slide 7-

What is DNA needed for? Genetic information is transferred from DNA and converted to protein RNA molecules work as messengers Proteins are the biological workers
Slide 8-

Information of the DNA is copied to a RNA molecule in transcription RNA directs the protein synthesis in a translation Protein’s 3D structure determines it’s function Information transfer only in one direction
Slide 9-

DNA (Deoxyribo Nucleic Acid) a polymer of nucleotide monomers 2’-deoxyribose sugar Four bases: Adenine, A Guanine, G Thymine, T Cytosine, C Sugar part Base part
Slide 10-

Four bases... Purine bases Adenine and guanine Two carbon rings Pyrimidine bases Thymine and cytosine A single carbon ring
Slide 11-

DNA chains Nucleotides are joined with phosphodiesteri bond Sequence of bases vary  genetic information Extremely long chains!
Slide 12-

DNA Molecules Two polynucleotide chains are joined Double helix, twisted in right handed way Full circle in every 10 bases
Slide 13-

”ladder-structure” Bases = steps Sugars and phosphates = supporting pilars Two nucleotide chains run in opposite directions chemical direction (5´-3´)
Slide 14-

Complementary Pairing Bases pair with other bases Space between the chains is limited  Purines with two carbon rings pair only with single ring pyrimidines A + T G + C Complementary pairing is vital for the use and storage of the genetic information! Interaction is stabilized by hydrogen bonds
Slide 15-

The Genetic Code Describes how nucleotide sequence is converted to protein sequence Unit of three nucleotides = a codon A codon codes for a specific amino acid (structural component of protein)
Slide 16-

The four bases can form 64 different codons 20 amino acids are found from the nature Regulatory codons
Slide 17-

Frame 1 Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q Frame 2 C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N Frame 1 G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H Right reading frame is obligatory! Part of the sequence from psoriasis associated gene HCR Three different reading frames can be used, but only one is the right one Translate tools are found from the internet atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc The right one
Slide 18-

DNA chromatin chromatin fibers fibers connected to chromosome scaffold Condenced scaffold Chromosome
Slide 19-

Genes A gene: DNA sequence that is needed to encode amino acid sequence of a protein Composed of exons, introns and different control elements Exon – protein coding sequence Intron – intervening sequence
Slide 20-

Genes vary a lot in size: Humans: average 3000bp largest 2.4 million bp Genes are separated by sequences with unknown function Only one strand of the DNA carries biological information  template strand Potential to store biological information is enormous
Slide 21-

That’s all for this time!
Slide 22-

The Human Genome and Inheritance
Slide 23-

3 billion base pairs about 22 000 genes Only 2 % of the DNA encode proteins Genes include exons and introns Beside coding areas also additional secuences are found 50 % repeated sequences (”junk DNA”) The Human genome... The different types of sequences that make up the total DNA of a human cell
Slide 24-

23 chromosome pairs  46 chromosomes 44 autosomes, 2 sex chromosomes X and Y –chromosomes XX  female XY  Male
Slide 25-

Chromosomes carrying the same genes are called homologous
Slide 26-

Mutations Alterations in DNA sequence Some are part of normal DNA variation Caused by chemical and physiological agents and errors in DNA replication Cells can repaire some mistakes If not repaired changes in DNA sequence are made permanent by DNA replication
Slide 27-

Point mutations: Single base mutations: 1. Missense mutation: leads to an amino acid change 2. Silent mutation: does not change the amino acid 3. Nonsense mutation: causes premature stop-codon
Slide 28-

Frameshift mutations: insertion/deletion dublication translocation Altered reading frame Severe impacts on protein structure
Slide 29-

Passing on the genetic information: Information passed on in the sexual reproduction Needed for new characteristics to develop Offspring recieve genes by inheriting chromosomes
Slide 30-

Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTCC CACTTTCAAGCTCGGCCCCTT TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG TTTCCAGTGACAGGCAG GCCAAGAATGGCTCCCACCT GGCTCTCAGACATTCCCCTGGTCCAACCCCCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA Genotype Phenotypes Genotype
Slide 31-

All somatic cells 23 chromosome pairs (46 chromosomes) Diploid cells, 2n Sperm cell 23 chromosomes Haploid cell, n Egg cell 23 chromosomes Haploid cell, n Fertilization: n n + Fertilized egg 2n 46 chromosomes
Slide 32-

A chromosome pare: A locus An allele
Slide 33-

Mitosis Division of somatic cells Products two daughter cells from one parent cell The number of chromosomes does not change DNA duplicates before entering the mitosis Takes 1-2 hours
Slide 34-

Meiosis Only in gamete formation One diploidic parent cell produces four haploid gametosytes Mature gametocytes have 23 chromosomes (n)
Slide 35-

Chromatids change parts between homologous chromatids during the meiosis Causes redistribution of heridary material between the homologous chromosomes  number of genes doesn’t change  new allele combinations are formed Crossing over:
Slide 36-

ppt slide no 36 content not found
Slide 37-

Inherited diseases DNA mutations are significant in development of diseases Inherited diseases are caused by mutations passed from a parent to a offspring Monogenic diseases: disease is caused by one mutation in one gene Multifactiorial diseases: disease is caused by interaction of different mutations and environmental factors Mendelian inheritance: Presence or absence of the phenotype depends on the genotype at a single locus
Slide 38-

Dominant character: only one allele needed to cause the phenotype (heterozygous) Recessive character: both allels needed to cause the phenotype (homozygous)
Slide 39-

ppt slide no 39 content not found
Slide 40-

Autosomal dominant inheritance: Aa aa Aa Aa aa
Slide 41-

Autosomal recessive inheritance: aa aa aa Aa Aa Aa AA aa Aa
Slide 42-

X-chromosome linked recessive inheritance:
Slide 43-

X-chromosome linked dominant inheritance:
Slide 44-

ppt slide no 44 content not found